[Vision2020] America's finest News Source...

[Ron Force]

Gets it right again:

McDonald’s Won’t Use GMO ‘Innate’ Potatoes
AMERICAN VOICES • Opinion • ISSUE 50•46 • Nov 18, 2014   
   - 1.6K
   - 144
   - 41
McDonald’s has announced that even though the FDA approved a new genetically modified potato called the Innate potato, which has DNA that has been altered so it doesn’t naturally produce cancer-causing chemicals when cooked at high temperatures, the company will not use them for french fries. What do you think?   
   - “Good call. Everyone knows a french fry’s flavor comes from its unmodified ACTGCGCATCTTGCAATATCGAGCA DNA sequence.”Carol Clement –    
Rope Course Designer
   - “When will these scientists stop playing God and just let food give us cancer?”Donald Lappin –    
Lampshade Collector
   - “At least we know they use potatoes.”John Krieger –    
Unemployed
   
   - 
   - 
   - 
Facebook Reportedly Building LinkedIn-Style ‘Facebook At Work’
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.fsr.com/pipermail/vision2020/attachments/20141123/e3e9cf6b/attachment.html>